Preview

Журнал микробиологии, эпидемиологии и иммунобиологии

Расширенный поиск

Молекулярно-генетическое исследование штамма Ленинград-16, используемого для производства вакцины кори

https://doi.org/10.36233/0372-9311-2020-97-2-182-189

Полный текст:

Аннотация

Целью данной работы было изучение генетической стабильности производственного штамма Ленинград-16 (Л-16) вируса кори, используемого для производства вакцины АО «НПО «Микроген».

Материалы и методы. В исследовании использованы серии производственного и посевного штаммов Л-16 (АО «НПО «Микроген»), готовые серии вакцин кори различных производителей, штамм генотипа D6 вируса кори. Молекулярно-генетическое исследование штаммов проведено с применением полимеразной цепной реакции с обратной транскрипцией, последующей рестрикцией и секвенированием.

Результаты. Получены полногеномные последовательности производственного и посевного штаммов Л-16 для производства вакцины. Последовательность вакцинного штамма представлена в GenBank. Штамм Л-16 генетически стабилен. Полученные данные позволили продемонстрировать возможность использования метода ОТ-ПЦР с последующей рестрикцией для подтверждения подлинности вакцинного штамма Л-16 в готовых моно- и трехкомпонентных формах вакцин.

Заключение. Результаты проведенного исследования позволяют предположить возможность применения молекулярно-генетических методов для подтверждения подлинности изученных штаммов не только на этапах производства, но и в готовых сериях вакцин.

Корь является высококонтагиозным заболеванием, характеризующимся в продромальном периоде лихорадкой, кашлем, насморком, конъюнктивитом, с последующим появлением генерализованной макулопапулезной сыпи [1, 2]. Вирус кори, вызывающий данное заболевание, относится к роду Morbillivirus, семейству Paramyxoviridae [1, 2]. На основании данных о нуклеотидной последовательности различают 24 генотипа вируса кори. Генотипирование проводят по нуклеотидной последовательности не менее 450 п.н., кодирующей СООН-концевой фрагмент белка нуклеопротеина N [1, 2]. Средством профилактики заболевания является использование живой вакцины кори, для производства которой применяют аттенуированные штаммы. Штаммы Moraten, AIK-C, Schwarz, Edmonston-Zagreb и Edmonston B получены из исходного штамма Edmonston, штаммы cAm-70, Shanghai-191, Changchun-47 и Ленинград-16 (Л-16) получены независимо [3-6]. При этом штаммы Changchun-47 и Л-16 пассировались на разных культурах клеток, но имеют общего «прародителя» — штамм Ленинград-4. Все указанные вакцинные штаммы относятся к генотипу А [2-6].

В России вакцина коревая культуральная живая производится АО «НПО «Микроген» и ФБУН ГНЦ ВБ «Вектор». Оба производителя используют один штамм — Л-16. Современные требования к производству вакцинных препаратов, содержащих живые штаммы вирусов, предполагают контроль генетической стабильности производственных штаммов, в том числе штаммов вируса кори (ШВК), что рекомендовано International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (Международная конференция по гармонизации технических требований к регистрации лекарственных препаратов для человека)1 и Государственной фармакопеей РФ2. Все производители, кроме Serum Institute of India (Индия), сделали доступной информацию о нуклеотидной структуре производственных ШВК и об их генетической стабильности [3-6]. Информация о нуклеотидной структуре штаммов для контроля подлинности вакцинных штаммов, причем не только на этапах производства, но и в готовых сериях вакцины, позволяет применить молекулярно-генетические методы.

Государственная фармакопея РФ для подтверждения подлинности производственного ШВК, как и производственных штаммов паротита и краснухи, регламентирует использование реакции нейтрализации2. Для вирусов кори, паротита и краснухи известен высокий серологический перекрест между штаммами — иммунная сыворотка, полученная к вакцинному штамму, обладает вируснейтрализующей активностью по отношению к другим штаммам семейства [7-11]. Таким образом, метод нейтрализации вакцинного штамма специфической иммунной сывороткой позволяет только подтвердить принадлежность исследуемого вакцинного штамма вируса к роду и семейству. Напротив, метод полиморфизма длин рестрикционных фрагментов (ПДРФ) (restriction fragment length polymorphism — RFLP) позволяет подтвердить подлинность именного вакцинного штамма, что было продемонстрировано для вируса паротита Ленинград-3, вируса краснухи штамма RA-27/3 и ШВК Shanghai-191 [11-13].

Целью настоящей работы было исследование структуры производственного и посевного ШВК Л-16, используемого АО «НПО «Микроген» для производства моновалентной и трехкомпонентной вакцин, а также изучение возможности применения молекулярно-генетических методов для подтверждения подлинности производственного штамма в готовой форме вакцины.

Материалы и методы

В работе использован вирус кори генотипа D6 (MV226, Mvi/Luxembourg lUx/30/97/2), любезно предоставленный доктором C.P. Muller [8]. Штамм применялся в качестве контроля при проведении рестрикционного анализа вакцинных ШВК.

В работе использованы вакцины следующих производителей:

  • АО «НПО «Микроген»:
  • производственный ШВК Л-16 (серия № 10);
  • посевной ШВК Л-16 (серия № 200);
  • комбинированная вакцина против кори, краснухи и паротита «Вактривир» (серии М0015эк, М0020эк, М0021эк);
  • вакцина против краснухи культуральная живая аттенуированная (одна серия);
  • вакцина паротитная (штамм Ленинград-3, одна серия);
  • вакцина коревая живая аттенуированная (штамм Л-16, три серии);
  • «Serum Institute of India» — вакцина против кори, паротита и краснухи живая аттенуированная (четыре серии);
  • «GlaxoSmithKlien Biologicals» — «Приорикс», вакцина против кори, паротита и краснухи живая аттенуированная (три серии);
  • «Merck & Co., Inc.» — «ProQuad», вакцина против кори, паротита, краснухи и ветряной оспы (одна серия).

Для выделения РНК из образцов применяли набор «РИБО-сорб» («АмплиСенс», Россия), выделенная РНК находилась в объеме 50 мкл.

При проведении реакции обратной транскрипции (ОТ) и гидролиза эндонуклеазой рестрикции использовали ферменты и компоненты реакционных смесей производства НПО «СибЭнзим» (Россия).

Плазмида pUCL16 (НПО «СибЭнзим», кат. № D19) служила в качестве положительного контроля при проведении ОТ-ПЦР и ПДРФ. ДНК плазмиды pUCL16 составляет 3568 п.н. Плазмида содержит уникальные сайты узнавания для EcoR1, Sac1, Kpn1, Xma1, BamH1, Xba1, Sal1, HincII, Acc1, Pst1, BspM1, Sph1 и HindIII, локализованные в полилинкере. Плазмида содержит вставку фрагмента кДНК вируса кори, штамм Л-16, длиной 882 п.н., соответствующие позициям 1466-2324 п.н. в геноме вируса кори. Фрагмент имеет сайты рестрикции рестриктазами BstSFI и CciI .

Реакция ОТ проводилась в условиях, подробно описанных ранее [12]. Полимеразная цепная реакция (ПЦР) осуществлялась в тех же пробирках, что и ОТ, поскольку все необходимые для ПЦР компоненты уже содержались в растворах, а матрицей служила кДНК, наработанная с вирусной РНК. Режим термоциклирования полностью соответствовал описанному ранее [12].

После прохождения ПЦР к 25 мкл полученной смеси добавляли 5 мкл буфера для рестрикции «ROSE» (кат. № B021) и 20 мкл воды, затем делили на 2 аликвоты по 25 мкл и к одной из них добавляли 1 мкл рестриктазы CGI. После инкубации в течение 1 ч при 37°С пробы наносили на 1,5% агарозный гель и проводили электрофорез в TAEбуфере.

Для определения полных последовательностей производственного штамма и посевного ШВК Л-16 (АО «НПО «Микроген») были синтезированы праймеры, полностью перекрывающие последовательность генома вируса кори с шагом 500 п.н. [14].

Секвенирование проводили на приборе «Prism 310 Genetic Analyzer» с использованием набора «BigDye Terminator v.3.1 Cycle Sequencing Kit» («Applied Biosystems»). Данные секвенирования анализировали с помощью программы «Chromas 2.22» («Technelysium Pty Ltd.»).

Результаты

Изучение первичной структуры полноразмерных геномов производственного и посевного ШВК Л-16

Производственный ШВК Л-16 (серия № 10, приготовленная в 1993 г.) прошел 21 пассаж в первичной культуре клеток почек морских свинок и 4 пассажа в первичной культуре клеток фибробластов японских перепелов. Посевной ШВК Л-16 (серия № 200, приготовленная в 2003 г.) прошел 21 пассаж в первичной культуре клеток почек морских свинок и 6 пассажей в первичной культуре клеток фибробластов японских перепелов. В процессе производства готовой серии вакцины посевной вирус проходит 1 пассаж в культуре клеток фибробластов японских перепелов.

Результаты секвенирования кДНК производственного штамма представлены в GenBank (№ JF727649). Сравнительные результаты секвенирования кДНК посевного вируса и кДНК, полученной из готовой серии вакцины (GenBank JF727650), приготовленной из указанного посевного вируса, свидетельствуют о том, что нуклеотидные последовательности идентичны последовательностям производственного штамма. Это говорит о том, что штамм Л-16 АО «НПО «Микроген» генетически стабилен на этапах производства вакцины.

Выбор фрагмента ШВКЛ-16, пригодного для подтверждения подлинности штамма методом ПДРФ

Для ШВК Л-16 выбор фрагментов для дальнейшего использования ПДРФ осуществлялся в соответствии с критериями, описанными ранее [12].

Для анализа из базы данных GenBank выбраны референсные последовательности всех 24 геномов вируса кори и всех вакцинных штаммов. В качестве первого шага анализа проведено сравнение референсных последовательностей по СООН-концевому фрагменту белка нуклеопротеина N позиции 1126— 1575 н.о., т.е. области, используемой для генотипирования. Анализ множественного выравнивания показывает, что референсная последовательность генотипа А вируса кори отличается от референсных последовательностей других генотипов в позиции 1547 (нуклеотидный остаток Т, в то время как в других последовательностях — G). Нуклеотидный остаток Т входит в состав сайта узнавания рестриктазы BstSFI (CTATAG), что делает возможным использование метода ПДРФ для дифференциации генотипа А от других генотипов за один шаг. Из 48 полногеномных последовательностей генотипа А вируса кори, представленных в GenBank, 43 содержат сайт узнавания рестриктазы BstSFI в виде последовательности CTATAG. Среди вакцинных штаммов только штамм Shanghai-191 не содержит этого сайта.

Проведенный BLAST-анализ не выявил присутствия сайта этой рестриктазы в данном участке генома в штаммах, относящихся к другим генотипам. Таким образом, метод ПДРФ с использованием рестриктазы BstSFI (SfeI) может позволить с высокой степенью точности (~90%) определить принадлежность штамма к генотипу А.

Для анализа нуклеотидных последовательностей выбраны полные последовательности геномов вакцинных штаммов вируса кори из базы данных GenBank: AIK-С (AF266286, AB046218), Moraten (AF266287), Morten (FJ211583), Schwartz (FJ211589), Edmonston-Zagreb (AY486083), CAM-70 (DQ345722, DQ345721), Changchun-47 (FJ416068), Shanghai (FJ416067), Л-16 (JF727650, JF727649). Множественное выравнивание последовательностей вакцинных штаммов и референсного штамма генотипа А Edmonston с целью выявления нуклеотидных замен, присущих только ШВК Л-16, показало, что этот штамм имеет уникальные замены (таблица).

 

Сравнение отличий геномов штамма Л-16 и других вакцинных штаммов

Comparison of differences in the genomes of Leningrad-16 strain and other vaccine strains

 

Позиция

Position

 

Нуклеотид в геноме штамма Л-16 (контекстная последовательность)

Nucleotide in the genome of Leningrad-16 strain (context sequence)

Нуклеотид в других вакцинных штаммах (контекстная последовательность)

Nucleotide in other vaccine strains (context sequence)

2143

3586

7190

9117

C

TTATTATGTTCATGATCACAG

С

GATGAATGCTCTATGTACATG

T

AGCATCAAGCTCACCTGAAAT

A

GGAACCAATCACAGATAGGGC

T

TYRTTAYGTTWGATCACAG

Т

GATGAATGCT^ATGTACATG

C

AGCATCAAGCCCACCTGAAAT

G

GGAACCAATCGCAGATAGGGC

Две из 4 уникальных замен формируют сайты эндонуклеаз рестрикции (подчеркнуты в таблице), которые можно использовать для дифференциации ШВК Л-16 с помощью метода ПДРФ. Это сайты TCATGA (CciI) и CATG (FatI и FaeI) возле позиции 2143, а также сайт AGCT (AluI и AluBI) возле позиции 7190. Для проведения гидролиза кДНК представляется удобным применять более крупнощепящую рестриктазу CciI.

BLAST-анализ фрагмента, который содержит сайт TCATGA у ШВК Л-16, показал, что этот сайт не содержится ни в одном из опубликованных геномов других ШВК — как принадлежащих к генотипу А (включая все вакцинные штаммы), так и в других генотипах. Таким образом, этот сайт может служить уникальным маркером данного вакцинного штамма.

Выбор праймеров для амплификации участка генома с сайтом TCATGA в позиции 2143, расчет длин фрагментов, образующихся при гидролизе ПЦР-продукта

Для амплификации фрагмента, содержащего сайт TCATGA, были подобраны праймеры, позволяющие амплифицировать фрагмент длиной 378 п.н.: L1970f 5' CAG GCA GTT CGG GTC TCA GCA 3'; L2324r 5' CAG AAG CCC TGA ACC CCA TAG AGA 3'. В результате ПЦР с применением этих праймеров будет амплифицироваться фрагмент ДНК длиной 378 п.н., содержащий сайт рестриктазы CciI, имеющийся только у штамма Л-16. После обработки рестриктазой CciI этот фрагмент (в случае использования в реакции кДНК штамма Л-16) распадется на 2 фрагмента с длинами 175 и 203 п.н. В качестве положительного контроля при проведении реакции возможно использование плазмиды ДНК pUCL16 (НПО «СибЭнзим»).

При применении вышеописанных праймеров будет получен фрагмент длиной 378 п.н. При гидролизе фрагмента рестриктазой CciI будут получены фрагменты длиной 175 и 203 п.н. При использовании праймеров для амплификации фрагмента для генотипирования [2, 14] будет получен фрагмент длиной 481 п.н. с сайтом рестрикции рестриктазой BstSFI. При гидролизе фрагмента рестриктазой BstSFI будут получены фрагменты длиной 188 и 293 п.н. (рис. 1).

 

Рис. 1. Гидролиз ПЦР-продуктов, полученных после амплификации фрагментов ДНК плазмиды pUCL16.

1 — ампликон длиной 481 п.н., содержащий сайт рестрикции рестриктазой BstSFI; 2 — продукты гидролиза ампликона рестриктазой BstSFI (188 и 293 п.н.); 3 — маркер длин фрагментов «100 bp» (НПО «СибЭнзим»); 4 — ампликон длиной 378 п.н., содержащий сайт рестрикции рестриктазой CciI; 5 — продукты гидролиза ампликона рестриктазой CciI (175 и 203 п.н.).

Fig. 1. Cleavage of PCR products amplified from plasmid pUCL16.

1 — amplicon of 481 bp in length carrying a recognition site of restriction enzyme BstSFI; 2 — products of amplicon hydrolysis by BstSFI restrictione nzyme (188 and 293 bp); 3 — DNA marker of fragment lengths «100 bp» (NPO SibEnzyme); 4 — amplicon of 378 bp in length carrying a recognition site of restriction enzyme CciI; 5 — products of amplicon hydrolysis by restriction enzyme CciI (175 and 203 bp).

 

Результаты ОТ-ПЦР с последующей рестрикцией рестриктазой CciI в образцах, содержащих ШВК

Для выделения РНК и последующего проведения ОТ-ПЦР с рестрикцией использовали ШВК и образцы готовых форм вакцины различных производителей. Результат ОТ-ПЦР с последующ ей рестрикцией представлен на рис. 2. При амплификации посевного штамма и штамма из готовой формы вакцины получен ампликон с предполагаемой расчетной длиной 378 п.н. При рестрикции полученного ампликона рестриктазой CciI получены 2 фрагмента с расчетными длинами 175 и 203 п.н.

При проведении ОТ-ПЦР с последующей рестрикцией ШВК генотипа D6, готовых форм вакцин различных производителей, содержащих разные ШВК, получен ампликон расчетной длины, однако результат его рестрикции рестриктазой CciI отрицательный: фрагменты с расчетными длинами 175 и 203 п.н. не получены (рис. 2). Это связано с тем, что штаммы других генотипов вируса кори и ШВК, используемые другими производителями, не содержат сайт рестрикции Ccil во фрагменте генома с 1970 по 2324 н.о.

При проведении в тех же условиях ОТ-ПЦР с последующей рестрикцией вакцин против паротита и краснухи производства АО «НПО «Микроген» фрагмент длиной 378 п.н. амплифицирован не был, т.е. результат был отрицательным.

Таким образом, выбранные праймеры позволяют провести ОТ-ПЦР всех РНК, выделенных из образцов, содержащих вирус кори, и получить ампликон размером 378 п.н. (рис. 2). Только те фрагменты, которые содержат сайт рестрикции для рестриктазы CciI, характерный для ШВК Л-16, при проведении рестрикции позволяют получить 2 фрагмента длинами 175 и 203 п.н.

 

Рис. 2. Результаты ПДРФ-анализа продуктов ОТ-ПЦР образцов РНК, полученных из вакцин различных производителей, содержащих и не содержащих штамм Л-16 вируса кори. Дорожки 1, 18 : маркер длин фрагментов «100 bp» (НПО «СибЭнзим»); 2 — ампликон плазмиды pUCL16 (378 п.н.); 3 — ПДРФ-анализ ампликона плазмиды pUCL16 (175 и 203 п.н.); 4 — ампликон,полученный в результате ОТ-ПЦР препарата РНК, выделенного из посевного штамма Л-1; 5 — ПДРФ-анализ ампликона на дорожке 4» 6 — ампликон, полученный в ре зультате ОТ-ПЦР препарата РНК, выделпнного из готовой сери и моновакцины ко°и (штамм Л-16, /АО «НПО « IVIикроген»); 7 — ПдРФ-ан алим амплнкОна на дорожке 6; 8 — амплккон, полученный в результате ОТ-ПЦР препарата РНК, выделенного из готовой серии вакцины «Вактивир» (АО «НПО «Миамоген»); 9 — ПДРФ-анализ амплакона на дорожке 8; 10 — ампликон, получеаный в результате ОТ-ПЦР препаната РНК, выделенного из готооой серии вакцины Serum Institute of India; 11 — ПДРФ-анализ ампликона на дорожке РР. 12 — нмпликон,полученный в результате ОТ-ПЦР препарат. РНК, выделенного из готовой серив вакцины GSKC; 13 — ПДРФ-анализ амплиаона на дорожке 12; 14 — амцликоа, полученный и результате ОТ-ПЦР преппрата РНК, мыдиленного из готовой серии вакццны «Merck»; 15 — ПДРФ-анализ ампликона на дорожке 14; 16 — ампликон, полученный в результате ОТ-ПЦР препарата РНК, выделенного из штамма вируса кори генотипа D4; 17 — ПДРФ-анализ ампликона на дорожке 16; 18 — ампликон, полученный в результате ОТ-ПЦР препарата РНК, выделенного из готовой серии вакцины паротита АО «НПО «Микроген»; 19 — ампликон, полученный в результате ОТ-ПЦР препарата РНК, выделенного из готовой серии вакцины краснухи АО «НПО «Микроген».

Fig. 2. RLFP analysis of RT-PCR of RNA samples isolated from various manufacturers' vaccines containing and not containing the Leningrad-16 strain of the measles virus. Lines 1, 18: DNA ladder «100 bp» («SibEnzyme»); 2 — amplicon of plasmid pUCL16 (378 bp); 3 — RFLP analysis of the amplicon on line 2 (175 and 203 bp); 4 — amplicon produced by RT-PCR of RNA isolated from a sowing Leningrad-16 strain; 5 — RFLP analysis of the amplicon on line 4; 6 — amplicon produced by RT-PCR of RNA isolated from final series of measles monovaccine (Leningrad-16 strain, «Microgen»); 7 — RFLP analysis of the amplicon on line 6; 8 — amplicon produced by RT-PCR of RNA preparation isolated from the final series of the vaccine «Vactivir» («Microgen»); 9 — RFLP analysis of the amplicon on line 8; 10 — amplicon produced by RT-PCR of RNA isolated from final series of vaccines from Serum Institute of India; 11 — RFLP analysis of the amplicon on line 10; 12 — amplicon produced by RT-PCR of RNA isolated from final series of vaccines GSK; 13 — RFLP analysis of the amplicon on line 12; 14 — amplicon produced by RT-PCR of RNA isolated from final series vaccines «Merck»; 15 — RFLP analysis of the amplicon on line 14; 16 — amplicon produced by RT-PCR of RNA, isolated from a strain of measles virus genotype D4; 17 — RFLP analysis of the amplicon on line 16; 18 — amplicon produced by RT-PCR of RNA isolated from final series of vaccine mumps («Microgen»); 19 — amplicon produced by RT-PCR of RNA isolated from final series of vaccine rubella («Microgen»).

 

Таким образом, предложенный для амплификации с последующей рестрикцией фрагмент ШВК Л-16 позволяет подтвердить подлинность штамма не только на этапах производства, но и в готовой форме вакцины.

Применение подобранных праймеров для амплификации фрагмента длиной 378 п.н. и эндонуклеазы рестрикции CciI позволяет отличить ШВК Л-16 от ШВК, используемых при производстве других вакцин, с помощью ПДРФ.

Заключение

ШВК Л-16 для производства коревой вакцины генетически стабилен на всех этапах производства. Более специфичными для подтверждения подлинности вакцинных штаммов являются молекулярно-генетические методы контроля. Метод ПДРФ применим и для подтверждения подлинности ШВК Л-16 и может быть использован не только на стадиях производства вакцины, но и в готовой форме препарата — как в моно-, так и в комбинированных вакцинах.

Список литературы

1. Moss W. Measles. Lancet. 2017; 390(10111): 2490-502. DOI: http://doi.org/10.1016/S0140-6736(17)31463-0

2. Measles virus nomenclature update: 2012. Wkly Epidemiol. Rec. 2012; 87(9): 73-81.

3. Bankamp B., Takeda M., Zhang Y., Xu W., Rota P.A. Genetic characterization of measles vaccine strains. J. Infect. Dis. 2011; 204(Suppl. 1): S533-48. DOI: http://doi.org/10.1093/infdis/jir097

4. Borges M.B., Caride E., Jabor A.V., Malachias J.M., Freire M.S., Homma A., et al. Study of the genetic stability of measles virus CAM-70 vaccine strain after serial passages in chiсken embryo fibroblast primary cultures. Virus Genes. 2008; 36(1): 35-44. DOI: http://doi.org/10.1007/s11262-007-0173-1

5. Tillieux S.L, Halsey W.S, Sathe G.M, Vassilev V. Comparative analysis of the complete nucleotide sequences of measles, mumps, and rubella strain genomes contained in Priorix-Tetra and ProQuad live attenuated combined vaccines. Vaccine. 2009; 27(16): 2265-73. DOI: http://doi.org/10.1016/j.vaccine.2009.01.112

6. Zhang Y., Zhou J., Bellini W., Xu W., Rota P.A. Genetic characterization of Chinese measles vaccines by analysis of comple tegenomic sequences. J. Med. Virol. 2009; 81(8): 1477-83. DOI: http://doi.org/10.1002/jmv.21535

7. Отрашевская Е.В., Букин Е.К., Красильников И.В., Игнатьев Г.М. Специфический гуморальный иммунитет после однократной иммунизации паротитной вакциной: результаты трехлетнего наблюдения. Вопросы вирусологии. 2011; 56(3): 45-8.

8. Atrasheuskaya A.V., Kulak M.V., Neverov A.A., Rubin S., Ignatyev G.M. Measles cases in highly vaccinated population of Novosibirsk, Russia, 2000–2005. Vaccine. 2008; 26(17): 2111-8. DOI: http://doi.org/10.1016/j.vaccine.2008.02.028

9. Kanbayashi D., Kurata T., Takahashi K., Kase T., Komano J. A novel cell-based high throughput assay to determine neutralizing antibody titers against circulating strains of rubella virus. J. Virol. Methods. 2018; 252: 86-93. DOI: http://doi.org/10.1016/j.jviromet.2017.11.011

10. McLean H.Q., Fiebelkorn A.P., Ogee-Nwankwo A., Hao L., Coleman L.A., Adebayo A., et al. Rubella virus neutralizing antibody response after a third dose of measles-mumps-rubella vaccine in young adults. Vaccine. 2018; 36(38): 5732-7. DOI: http://doi.org/10.1016/j.vaccine.2018.08.010

11. Xu C.P., Li M.H., He H.Q., Lu Y.Y., Feng Y. Laboratory diagnosis of vaccine-associated measles in Zhejiang Province, China. J. Microbiol. Immunol. Infect. 2017; 50(5): 578–85. DOI: http://doi.org/10.1016/j.jmii.2015.10.004

12. Игнатьев Г.М., Отрашевская Е.В., Суханова Л.Л., Сидоренко Е.С., Нетесова Н.А. Молекулярно-генетическое исследование штамма RA-27/3, используемого для производства вакцины против краснухи. Журнал микробиологии, эпидемиологии и иммунобиологии. 2019; (4): 38–46. DOI: http://doi.org/10.36233/0372-9311-2019-4-38-46

13. Кулак М.В., Белавин П.А., Нетесова Н.А., Юнасова Т.Н., Голикова Л.Н., Бёктемиров Т.А. и др. Дифференциация вакцинного штамма Л-3 от других штаммов вируса паротита методом ОТ-ПЦР. Биопрепараты. Профилактика, диагностика, лечение. 2008; (4): 7-10.

14. Neverov A.A., Riddell M.A., Moss W.J., Volokhov D.V., Rota P.A., Lowe L.E. Genotyping of measles virus in clinical specimens on the basis of oligonucleotide microarray hybridization patterns. J. Clin. Microbiol. 2006; 44(10): 3752-9. DOI: http://doi.org/10.1128/JCM.00998-06


Об авторах

Георгий Михайлович Игнатьев
д.м.н., проф., зам. руководителя производственного направления ФГБНУ «ФНЦИРИП им. М.П. Чумакова РАН», 108819, Москва, Россия


Елена Викторовна Отрашевская
начальник отдела вакцин, бактериофагов и пробиотиков АО «Научно-производственное объединение по медицинским иммунобиологическим препаратам «Микроген», 127473, Москва, Россия


Лидия Львовна Суханова
к.м.н., зам. директора по качеству, Московское предприятие бактерийных препаратов, АО «Научно-производственное объединение по медицинским иммунобиологическим препаратам «Микроген», 127473, Москва, Россия


Елена Серафимовна Сидоренко
директор Московского подразделения по производству бактерийных препаратов, АО «Научно-производственное объединение по медицинским иммунобиологическим препаратам «Микроген», 127473, Москва, Россия


Нина Александровна Нетесова
д.б.н., в.н.с. отдела геномных исследований ФБУН «Государственный научный центр вирусологии и биотехнологии «Вектор» Роспотребнадзора, 630559, р.п. Кольцово, Новосибирская область, Россия


Для корреспонденции: marburgman@mail.ru

Рецензия

Просмотров: 1003


Creative Commons License
Контент доступен под лицензией Creative Commons Attribution 4.0 License.


ISSN 0372-9311 (Print)
ISSN 2686-7613 (Online)